Regional Variation in Captures of Male Paralobesia viteana (Lepidoptera: Tortricidae) in Monitoring Traps in Michigan Is Not Due to Geographical Variation in Male Response to Pheromone

Regional Variation in Captures of Male Paralobesia viteana (Lepidoptera: Tortricidae) in Monitoring Traps in Michigan Is Not Due to Geographical Variation in Male Response to Pheromone
Paralobesia viteana (Clemens), grape berry moth, is a significant pest of grapes in Japanese North America. There’s substantial regional variation within the response of male P. viteana to intercourse pheromone-baited monitoring traps in Michigan vineyards. Males are readily captured in traps within the southwest area, whereas within the northwest only a few males are captured, regardless of larval infestation in grapes in each areas.
Y-tube olfactometers and area experiments decided the response of male moths from northern and southern populations to the pheromone mix utilized in monitoring lures and to females from each areas. In Y-tube alternative assessments, males responded equally to the usual pheromone mix, and males didn’t preferentially select females from both area.
In area trials, traps baited with unmated females had been deployed to check the choice of resident males for females from the 2 areas and for normal pheromone lures. In southwest Michigan vineyards, considerably extra males had been caught in traps with a 1.0-µg customary pheromone lure than in traps with captive females collected from vineyards in each areas or in traps with a clean lure management. An analogous sample of male captures amongst lure therapies was noticed in northwest vineyards, though many fewer males had been trapped and variations amongst therapies weren’t important.
We conclude that the noticed regional variations in male response to pheromone traps aren’t brought on by variation in pheromone-mediated behavioral responses, suggesting that different biotic and/or abiotic variations decide the regional variation in captures of this species.
The intercourse pheromone composition of alfalfa plant bugs, Adelphocoris lineolatus (Goeze), from Central Europe was investigated to check the speculation that insect species throughout a large geographical space can differ in pheromone composition. Potential interactions between the pheromone and a identified attractant, (E)-cinnamaldehyde, had been additionally assessed.
Coupled gasoline chromatography-electroantennography (GC-EAG) utilizing male antennae and risky extracts collected from females, beforehand proven to draw males in area experiments, revealed the presence of three physiologically energetic compounds. These had been recognized by coupled GC/mass spectrometry (GC/MS) and peak enhancement as hexyl butyrate, (E)-2-hexenyl butyrate and (E)-4-oxo-2-hexenal. A ternary mix of those compounds in a 5.4:9.0:1.Zero ratio attracted male A. lineolatus in area trials in Hungary.
Regional Variation in Captures of Male Paralobesia viteana (Lepidoptera: Tortricidae) in Monitoring Traps in Michigan Is Not Due to Geographical Variation in Male Response to Pheromone
Omission of both (E)-2-hexenyl-butyrate or (E)-4-oxo-2-hexenal from the ternary mix or substitution of (E)-4-oxo-2-hexenal by (E)-2-hexenal resulted in lack of exercise. These outcomes point out that this Central European inhabitants is comparable in pheromone composition to that beforehand reported for an East Asian inhabitants. Apparently, one other EAG-active compound, 1-hexanol, was additionally current in feminine extract. When 1-hexanol was examined together with the ternary pheromone mix, male catches had been decreased.
This compound confirmed a dose-response impact with small doses exhibiting a powerful behavioral impact, suggesting that 1-hexanol might act as a intercourse pheromone antagonist in A. lineolatus. Moreover, when (E)-cinnamaldehyde was area examined together with the intercourse pheromone, there was no improve in male catch, however the mixture attracted each men and women. Prospects for sensible utility are mentioned.
Anagrus atomus (L.) is an egg parasitoid concerned within the organic management of Empoasca vitis (Göthe) in vineyards. Intercourse pheromones play an important position in mate discovering for a number of parasitoid species and might be used for monitoring below area situations. We carried out laboratory and area research aimed toward assessing the existence and identification of a doable A. atomus intercourse pheromone.
We discovered that males had been considerably attracted by virgin females impartial of age. Males weren’t interested in people of the identical intercourse, however they had been attracted by a crude extract from an unmated feminine and its polar fraction. Eugenol (4-allyl-2-methoxyphenol) was recognized because the engaging substance and proved to be engaging not solely within the olfactometer but additionally in one other laboratory bioassay and below area situations.
Attraction of males, however not females, confirms that this isn’t an aggregation pheromone. That is the primary sex-pheromone part recognized in Mymaridae, nonetheless extra compounds might be concerned within the mating behaviour of A. atomus. The utility of a intercourse pheromone in A. atomus is mentioned within the context of health returns.
Biosynthesis of (1R,4aS,7S,7aR)-nepetalactol (1) and (4aS,7S,7aR)-nepetalactone (2) in vegetation entails iridoid synthase (ISY), an atypical reductive cyclase that catalyses the discount of 8-oxogeranial into the reactive enol of (S)-8-oxocitronellal, and cyclization of this enol intermediate, both non-enzymatically or by a nepetalactol-related brief chain dehydrogenase enzyme (NEPS) that yields the nepetalactols.
On this research, we investigated the biosynthesis in vivo of 1 and a pair of within the pea aphid, Acyrthosiphon pisum, utilizing a library of isotopically-labelled monoterpenoids as molecular probes. Topical utility of deuterium-labelled probes synthesized from geraniol and nerol resulted in manufacturing of 2 H4 -lactol 1 and 2 H4 -lactone 2.

Zyxin (ZYX) Antibody

20-abx100031
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Zyxin (ZYX) Antibody

20-abx116771
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zyxin (ZYX) Antibody

abx037464-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Zyxin (ZYX) Antibody

20-abx175170
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Zyxin (ZYX) Antibody

abx239764-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Zyxin (ZYX) Antibody

abx239765-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Zyxin (ZYX) Antibody

abx433465-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Zyxin (ZYX) Antibody

20-abx001747
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Zyxin (ZYX) Protein

20-abx069720
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Zyxin (ZYX) Protein

20-abx069721
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Zyxin (ZYX) Antibody (Biotin)

20-abx272263
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Zyxin (ZYX) Antibody (FITC)

20-abx273635
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Zyxin(ZYX) ELISA kit

CSB-EL027165HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Zyxin (ZYX) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Zyxin(ZYX) ELISA kit

1-CSB-EL027165HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Zyxin(ZYX) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Zyxin (ZYX) ELISA Kit

20-abx153537
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human ZYX/ Zyxin ELISA Kit

E2725Hu 1 Kit
EUR 605

Human Zyxin, ZYX ELISA KIT

ELI-53492h 96 Tests
EUR 824

Human Zyxin (ZYX) ELISA Kit

abx555876-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human Zyxin (ZYX) CLIA Kit

20-abx493561
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Zyxin(ZYX)ELISA Kit

GA-E1505HM-48T 48T
EUR 289

Human Zyxin(ZYX)ELISA Kit

GA-E1505HM-96T 96T
EUR 466

Zyxin (ZYX) Polyclonal Antibody (Human)

4-PAC235Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX)

Zyxin (ZYX) Polyclonal Antibody (Human)

4-PAC235Hu02
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX)

Zyxin (ZYX) Monoclonal Antibody (Human)

4-MAC235Hu21
  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX)

Human Zyxin(ZYX)ELISA Kit

QY-E04229 96T
EUR 361

Human Zyxin (ZYX) ELISA Kit

SEC235Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Zyxin (ZYX) ELISA Kit

SEC235Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Zyxin (ZYX) ELISA Kit

SEC235Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Zyxin (ZYX) ELISA Kit

SEC235Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Zyxin (ZYX) ELISA Kit

4-SEC235Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Zyxin elisa. Alternative names of the recognized antigen: ESP2
  • HED2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Zyxin (ZYX) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Zyxin ELISA Kit (ZYX)

RK02541 96 Tests
EUR 521

Chicken Zyxin, ZYX ELISA KIT

ELI-14746c 96 Tests
EUR 928

Chicken Zyxin (ZYX) ELISA Kit

abx555364-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.

Mouse Zyxin (ZYX) ELISA Kit

abx556120-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Mouse Zyxin, Zyx ELISA KIT

ELI-40811m 96 Tests
EUR 865

ELISA kit for Human ZYX (Zyxin)

ELK4891 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Zyxin (ZYX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Zyxin (ZYX). Next, Avi
  • Show more
Description: A sandwich ELISA kit for detection of Zyxin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Zyxin (ZYX)

KTE62447-48T 48T
EUR 332
  • Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Zyxin (ZYX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Zyxin (ZYX)

KTE62447-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Zyxin (ZYX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Zyxin (ZYX)

KTE62447-96T 96T
EUR 539
  • Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Zyxin (ZYX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Zyxin (ZYX) Polyclonal Antibody (Human), APC

4-PAC235Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC.

Zyxin (ZYX) Polyclonal Antibody (Human), Biotinylated

4-PAC235Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Biotin.

Zyxin (ZYX) Polyclonal Antibody (Human), Cy3

4-PAC235Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Cy3.

Zyxin (ZYX) Polyclonal Antibody (Human), FITC

4-PAC235Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with FITC.

Zyxin (ZYX) Polyclonal Antibody (Human), HRP

4-PAC235Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with HRP.

Zyxin (ZYX) Polyclonal Antibody (Human), PE

4-PAC235Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with PE.

Zyxin (ZYX) Polyclonal Antibody (Human), APC

4-PAC235Hu02-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC.

Zyxin (ZYX) Polyclonal Antibody (Human), Biotinylated

4-PAC235Hu02-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Biotin.

Zyxin (ZYX) Polyclonal Antibody (Human), Cy3

4-PAC235Hu02-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Cy3.

Zyxin (ZYX) Polyclonal Antibody (Human), FITC

4-PAC235Hu02-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with FITC.

Zyxin (ZYX) Polyclonal Antibody (Human), HRP

4-PAC235Hu02-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with HRP.

Zyxin (ZYX) Polyclonal Antibody (Human), PE

4-PAC235Hu02-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with PE.

Zyxin (ZYX) Monoclonal Antibody (Human), APC

4-MAC235Hu21-APC
  • EUR 358.00
  • EUR 3455.00
  • EUR 957.00
  • EUR 458.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC.

Zyxin (ZYX) Monoclonal Antibody (Human), Biotinylated

4-MAC235Hu21-Biotin
  • EUR 320.00
  • EUR 2592.00
  • EUR 760.00
  • EUR 394.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Biotin.

Zyxin (ZYX) Monoclonal Antibody (Human), Cy3

4-MAC235Hu21-Cy3
  • EUR 435.00
  • EUR 4565.00
  • EUR 1235.00
  • EUR 569.00
  • EUR 258.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Cy3.

Zyxin (ZYX) Monoclonal Antibody (Human), FITC

4-MAC235Hu21-FITC
  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with FITC.

Zyxin (ZYX) Monoclonal Antibody (Human), HRP

4-MAC235Hu21-HRP
  • EUR 327.00
  • EUR 3011.00
  • EUR 846.00
  • EUR 413.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with HRP.

Zyxin (ZYX) Monoclonal Antibody (Human), PE

4-MAC235Hu21-PE
  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with PE.

Zyxin (ZYX) Polyclonal Antibody (Human), APC-Cy7

4-PAC235Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC-Cy7.

Zyxin (ZYX) Polyclonal Antibody (Human), APC-Cy7

4-PAC235Hu02-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC-Cy7.

Zyxin (ZYX) Monoclonal Antibody (Human), APC-Cy7

4-MAC235Hu21-APC-Cy7
  • EUR 596.00
  • EUR 6790.00
  • EUR 1795.00
  • EUR 796.00
  • EUR 329.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC-Cy7.

Zyxin Phospho-Ser142 (ZYX pS142) Antibody

20-abx324004
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zyx ELISA Kit| Mouse Zyxin ELISA Kit

EF016536 96 Tests
EUR 689

ZYX ELISA Kit| chicken Zyxin ELISA Kit

EF012568 96 Tests
EUR 689

ZYX Recombinant Protein (Human)

RP036337 100 ug Ask for price

ZYX Recombinant Protein (Rat)

RP238847 100 ug Ask for price

ZYX Recombinant Protein (Mouse)

RP188411 100 ug Ask for price

Alleleustrious pmTFP1-Zyxin fusion vector Zyxin

ABP-FP-TZY 5 ug Ask for price
    • Product line: Plasmids
    • Brand: Organelle Markers

Alleleustrious pWasabi-Zyxin fusion vector Zyxin

ABP-FP-WZY 5 ug Ask for price
    • Product line: Plasmids
    • Brand: Organelle Markers

Zyxin Antibody

39205-100ul 100ul
EUR 390

Zyxin Antibody

49705-100ul 100ul
EUR 333

Zyxin Antibody

49705-50ul 50ul
EUR 239

Zyxin Antibody

AF7902 200ul
EUR 376
Description: Zyxin Antibody detects endogenous levels of Zyxin.

Zyxin Antibody

AF7903 200ul
EUR 376
Description: Zyxin Antibody detects endogenous levels of Zyxin.

anti-Zyxin

YF-PA15457 50 ul
EUR 363
Description: Mouse polyclonal to Zyxin

anti-Zyxin

YF-PA15458 50 ug
EUR 363
Description: Mouse polyclonal to Zyxin

anti-Zyxin

YF-PA15459 100 ug
EUR 403
Description: Rabbit polyclonal to Zyxin

anti-Zyxin

YF-PA25007 50 ul
EUR 334
Description: Mouse polyclonal to Zyxin

ZYX antibody

70R-21425 50 ul
EUR 435
Description: Rabbit polyclonal ZYX antibody

ZYX antibody

38377-100ul 100ul
EUR 252

ZYX Antibody

43893-100ul 100ul
EUR 252

ZYX Antibody

DF6858 200ul
EUR 304
Description: ZYX Antibody detects endogenous levels of total ZYX.

ZYX Antibody

1-CSB-PA027165GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ZYX. Recognizes ZYX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ZYX siRNA

20-abx941267
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZYX siRNA

20-abx941268
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZYX Antibody

ABD6858 100 ug
EUR 438

Recombinant Human Zyxin Protein, His, Mammal-100ug

QP10108-ma-100ug 100ug
EUR 1178

Recombinant Human Zyxin Protein, His, Mammal-20ug

QP10108-ma-20ug 20ug
EUR 462

Recombinant Human Zyxin Protein, His, Mammal-50ug

QP10108-ma-50ug 50ug
EUR 862

Human Zyxin ELISA kit

E01Z0034-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zyxin ELISA kit

E01Z0034-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zyxin ELISA kit

E01Z0034-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Zyxin ELISA KIT|Human

EF004535 96 Tests
EUR 689

Human ZYX shRNA Plasmid

20-abx955275
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Zyxin antibody (Ser142)

70R-34606 100 ug
EUR 327
Description: Purified Rabbit polyclonal Zyxin antibody (Ser142)

Zyxin Conjugated Antibody

C49705 100ul
EUR 397

Zyxin Blocking Peptide

AF7902-BP 1mg
EUR 195

Zyxin Blocking Peptide

AF7903-BP 1mg
EUR 195

anti- Zyxin antibody

FNab09764 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: zyxin
  • Uniprot ID: Q15942
  • Gene ID: 7791
  • Research Area: Cell Division and Proliferation, Signal Transduction
Description: Antibody raised against Zyxin

anti- Zyxin antibody

FNab09765 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: zyxin
  • Uniprot ID: Q15942
  • Gene ID: 7791
  • Research Area: Cell Division and Proliferation, Signal Transduction
Description: Antibody raised against Zyxin

Anti-Zyxin antibody

PAab09764 100 ug
EUR 412

Anti-Zyxin (2D1)

YF-MA11026 100 ug
EUR 363
Description: Mouse monoclonal to Zyxin

ZYX Blocking Peptide

DF6858-BP 1mg
EUR 195

ZYX Conjugated Antibody

C43893 100ul
EUR 397

ZYX Conjugated Antibody

C38377 100ul
EUR 397

ZYX cloning plasmid

CSB-CL027165HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1719
  • Sequence: atggcggccccccgcccgtctcccgcgatctccgtttcggtctcggctccggctttttacgccccgcagaagaagttcggccctgtggtggccccaaagcccaaagtgaatcccttccggcccggggacagcgagcctcccccggcacccggggcccagcgcgcacagatgggcc
  • Show more
Description: A cloning plasmid for the ZYX gene.

ZYX Rabbit pAb

A2135-100ul 100 ul
EUR 308

ZYX Rabbit pAb

A2135-200ul 200 ul
EUR 459

ZYX Rabbit pAb

A2135-20ul 20 ul
EUR 183

ZYX Rabbit pAb

A2135-50ul 50 ul
EUR 223

Anti-ZYX antibody

STJ26156 100 µl
EUR 277
Description: Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and along the actin cytoskeleton. Zyxin has an N-terminal proline-rich domain and three LIM domains in its C-terminal half. The proline-rich domain may interact with SH3 domains of proteins involved in signal transduction pathways while the LIM domains are likely involved in protein-protein binding. Zyxin may function as a messenger in the signal transduction pathway that mediates adhesion-stimulated changes in gene expression and may modulate the cytoskeletal organization of actin bundles. Alternative splicing results in multiple transcript variants that encode the same isoform.

Anti-ZYX antibody

STJ72081 100 µg
EUR 359

ZYX ORF Vector (Human) (pORF)

ORF012113 1.0 ug DNA
EUR 95

ZYX ELISA Kit (Human) (OKCA02157)

OKCA02157 96 Wells
EUR 833
Description: Description of target: Adhesion plaque protein. Binds alpha-actinin and the CRP protein. Important for targeting TES and ENA/VASP family members to focal adhesions and for the formation of actin-rich structures. May be a component of a signal transduction pathway that mediates adhesion-stimulated changes in gene expression.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL

ZYX ELISA Kit (Human) (OKCD00316)

OKCD00316 96 Wells
EUR 831
Description: Description of target: Adhesion plaque protein. Binds alpha-actinin and the CRP protein. Important for targeting TES and ENA/VASP family members to focal adhesions and for the formation of actin-rich structures. May be a component of a signal transduction pathway that mediates adhesion-stimulated changes in gene expression (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.061 ng/mL

ZYX ELISA Kit (Human) (OKEH08197)

OKEH08197 96 Wells
EUR 896
Description: Description of target: Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and along the actin cytoskeleton. Zyxin has an N-terminal proline-rich domain and three LIM domains in its C-terminal half. The proline-rich domain may interact with SH3 domains of proteins involved in signal transduction pathways while the LIM domains are likely involved in protein-protein binding. Zyxin may function as a messenger in the signal transduction pathway that mediates adhesion-stimulated changes in gene expression and may modulate the cytoskeletal organization of actin bundles. Alternative splicing results in multiple transcript variants that encode the same isoform.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 29pg/mL

Zyxin (Phospho-Tyr316) Antibody

13247-100ul 100ul
EUR 252
Nonetheless, deuterium incorporation was not evident utilizing labelled probes synthesized from (S)-citronellol. These outcomes recommend that iridoid biosynthesis in animals, particularly aphids, might observe a broadly related path to that characterised for vegetation.

Leave a Reply

Your email address will not be published. Required fields are marked *